Specificity: Binds unspecifically to double- and single-stranded DNA oligomers.
Host: Mouse
Application: SPR, ELISA
Summary
Specifications
Antibody Isotype
IgG
Clone
3D8
Species Reactivity
N/A
Immunogen
3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Conjugate
Unconjugated
Applications
Application Notes
Suitable for use in SPR, ELISA. Each laboratory should determine an optimum working titer for use in its particular application. Other applications have not been tested but use in such assays should not necessarily be excluded.
General Notes
The Hi-Puri™ Mouse Anti-ssDNA/dsDNA Monoclonal antibody (clone 3D8, product code DMAB-CPDB036)is a monoclonal antibody specifically directed against ssDNA/dsDNA. This product is validated for use in SPR, ELISA. Binds unspecifically to double- and single-stranded DNA oligomers. DMAB-CPDB036 is purified by affinity purification and supplied as a liquid formulation in PBS. It is available in multiple sizes, including 100 μg, 200 μg, 500 μg, and 1 mg. For long-term storage, the product should be stored at −20°C and repeated freeze–thaw cycles should be avoided. The product is shipped on dry ice. This product is intended for research use only and is not intended for diagnostic use.
Target
Alternative Names
Single Stranded DNA; ssDNA; DNA; dsDNA
Citations
Publication ()
Have you cited DMAB-CPDB036 in a publication? Let us know and earn a reward for your research.
My Review for Hi-Puri™ Mouse Anti-ssDNA/dsDNA Monoclonal antibody, clone 3D8
Creative Diagnostics products are for RESEARCH USE ONLY, please make sure your review is research based.
Required fields are marked with *
Terms and conditions:
We will select high-quality review customers and offer a $30 coupon for your next purchase.
All product reviews must be submitted in the English language.
Creative Diagnostics will not share any personal information of applicants, and all information will be treated with strict confidentiality and will not be sold or disclosed to a third party.