Mouse anti-Human PVRL3 monoclonal antibody, clone 2E2

Transcripts in platelets are largely produced in precursor megakaryocytes but remain physiologically active as platelets translate RNAs and regulate protein/RNA levels. Recent studies using transcriptome sequencing (RNA-seq) characterized the platelet transcriptome in limited number of non-diseased individuals. Here, we expand upon these RNA-seq studies by completing RNA-seq in platelets from 32 patients with acute myocardial infarction (MI). Our goals were to characterize the platelet transcriptome using a population of patients with acute MI and relate gene expression to platelet aggregation measures and ST-segment elevation MI (STEMI) (n = 16) vs. non-STEMI (NSTEMI) (n = 16) subtypes. Similar to other studies, we detected 9565 expressed transcripts, including several known platelet-enriched markers (e.g. PPBP, OST4). Our RNA-seq data strongly correlated with independently ascertained platelet expression data and showed enrichment for platelet-related pathways (e.g. wound response, hemostasis, and platelet activation), as well as actin-related and post-transcriptional processes. Several transcripts displayed suggestively higher (FBXL4, ECHDC3, KCNE1, TAOK2, AURKB, ERG, and FKBP5) and lower (MIAT, PVRL3, and PZP) expression in STEMI platelets compared to NSTEMI. We also identified transcripts correlated with platelet aggregation to TRAP (ATP6V1G2, SLC2A3), collagen (CEACAM1, ITGA2), and ADP (PDGFB, PDGFC, ST3GAL6). Our study adds to current platelet gene expression resources by providing transcriptome-wide analyses in platelets isolated from patients with acute MI. In concert with prior studies, we identify various genes for further study in regards to platelet function and acute MI. Future platelet RNA-seq studies examining more diverse sets of healthy and diseased samples will add to our understanding of platelet thrombotic and non-thrombotic functions.

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-gamma, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-gamma secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.