Human Nectin-3/CD113 ELISA Kit

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-gamma, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-gamma secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Mechanisms by which c-Myc (Myc) amplification confers aggressive medulloblastoma phenotypes are poorly defined. Here, we show using orthotopic models that high Myc expression promotes cell migration/invasion and induces metastatic tumors, which recapitulate aggressive histologic features of Myc-amplified primary human medulloblastoma. Using ChIP-chip analysis, we identified cell migration and adhesion genes, including Tsp-1/THBS1, ING4, PVRL3, and PPAP2B, as Myc-bound loci in medulloblastoma cells. Expression of Tsp-1 was most consistently and robustly diminished in medulloblastoma cell lines and primary human tumors with high Myc expression (n = 101, P = 0.032). Strikingly, stable Tsp-1 expression significantly attenuated in vitro transformation and invasive/migratory properties of high Myc-expressing medulloblastoma cells without altering cell proliferation, whereas RNA interference-mediated Myc knockdown was consistently accompanied by increased Tsp-1 levels and reduced cell migration and invasion in medulloblastoma cells. Chromatin immunoprecipitation (ChIP) assays revealed colocalization of Myc and obligate partner Max and correlated diminished RNA polymerase II occupancy (similar to 3-fold decrease, P < 0.01) with increased Myc binding at a core Tsp-1 promoter. Reporter gene and/or gel shift assays confirmed direct repression of Tsp-1 transcription by Myc and also identified JPO2, a Myc interactor associated with metastatic medulloblastoma, as a cofactor in Myc-mediated Tsp-1 repression. These findings indicate the Myc-regulatory network targets Tsp-1 via multiple mechanisms in medulloblastoma transformation, and highlight a novel critical role for Tsp-1 in Myc-mediated aggressive medulloblastoma phenotypes. Cancer Res; 70(20); 8199-210. (C) 2010 AACR.