MAP3K7 blocking peptide

Background: We have previously demonstrated a Toll-like receptor (TLR)-mediated hyper-responsive phenotype in our cohort of localized aggressive periodontitis (LAP) individuals. However, mechanisms related to this phenotype are still not clear in the literature. The objective of this cross-sectional study is to examine the role of epigenetic regulation, specifically DNA methylation status of genes in the TLR pathway in this cohort. Peripheral blood was collected from 20 LAP patients and 20 healthy unrelated controls. Whole blood was stimulated with 1 mu l (100 ng/mu l) of purified Escherichia coli lipopolysaccharide (LPS) for 24 h and cyto/chemokines in the supernatants analyzed by Luminex multiplex assays. Genomic DNA extracted from buffy coats prepared from a second tube of whole blood was used for DNA methylation analysis by pyrosequencing of seven TLR signaling genes (FADD, MAP3K7, MYD88, IL6R, PPARA, IRAK1BP1, RIPK2). Results: Significant differences in the methylation status were observed at specific CpG positions in LAP patients compared to healthy controls and interestingly also between severe and moderate LAP. Specifically, subjects with moderate LAP presented hypermethylation of both the upregulating (MAP3K7, MYD88, IL6R, and RIPK2) and downregulating (FADD, IRAK, and PPARA) genes, while severe LAP presented hypomethylation of these genes. Further analysis on CpG sites with significant differences in methylation status correlates with an increased pro-inflammatory cytokine profile for LAP patients. Conclusions: Our findings suggest that epigenetic modifications of genes in the TLR pathway may orchestrate the thresholds for balancing induction and prevention of tissue destruction during the course of disease, and thus differ significantly at different stages of the disease, where moderate LAP shows hypermethylation and severe LAP shows hypomethylation of several genes.

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-gamma Elispot responses (38 vs. 26 spot-forming cells per 2 x 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-alpha, IFN-gamma, IFN lambda-1, and TNF-alpha secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.