E. coli LexA (DAG-P2719)

E. coli LexA (full length), recombinant protein from E. coli Datasheet

Online Inquiry Add to basket

Product Overview
E. coli LexA full length protein
Nature
Recombinant
Tag/Conjugate
Unconjugated
Purity
> 90 % by SDS-PAGE.highly purified by several steps of chromatography
Format
Liquid
Buffer
Preservative: None Constituents: 50% Glycerol, 5mM Beta mercaptoethanol, 2mM EDTA, 100mM Sodium chloride, 10mM Tris HCl, pH 7.5
Storage
Shipped at 4°C. Upon delivery aliquot and store at -20°C. Avoid freeze / thaw cycles. Preservative: None Constituents: 50% Glycerol, 5mM Beta mercaptoethanol, 2mM EDTA, 100mM Sodium chloride, 10mM Tris HCl, pH 7.5
Introduction
Escherichia coli; commonly abbreviated E. coli) is a gram-negative, facultatively anaerobic, rod-shaped bacterium of the genus Escherichia that is commonly found in the lower intestine of warm-blooded organisms (endotherms). Most E. coli strains are harml
Antigen Description
E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA's self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As the result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced.
Keywords
Lex A; LexA repressor; E. coli LexA; Escherichia coli LexA

Citations


Have you cited DAG-P2719 in a publication? Let us know and earn a reward for your research.

Customer Reviews


Write a review, share your experiences with others and get rewarded !

Online Inquiry

Name
Phone *
E-mail Address *
Service & Products Interested *
Project Description
Verification Code * Please input "diagnostics" as verification code.

Online Inquiry

Order Info: E. coli LexA

Online Inquiry
  Interested in larger quantities ? request a quote!
  Protocol may be improved. Please feel free to contact us to obtain the latest version.!
  15% off your first purchase

Ordering Information

Payment methods we support:
Invoice / Purchase Order
Credit card

OUR PROMISE TO YOU Guaranteed product quality expert customer support

Inquiry Basket